 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circ_0002138 | |||
| Gene | n/a | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
| DBLink | Link to database | PMID | https://www.sciencedirect.com/science/article/pii/S0753332218380016 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | 35 paired CRC tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AGACACTCTGTGCTTTATGGC ReverseCCATTCACATACCTTCCACA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| https://www.sciencedirect.com/science/article/pii/S0753332218380016 | |||